Clinical Proteomics:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Blocking Assay:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Polymer:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Red Blood Cell Lysis:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Virus:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Recombinant:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Modification:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Lysis:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Extraction:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Injection:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
Staining:Article Title: FAK inhibition in ovarian cancer releases omega-3 fatty acids to program CXCL13-producing anti-tumor resident peritoneal macrophages.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER UltraPolymer Goat anti-Rat IgG (H&L) – HRP Cell IDx Cat# 2AH-050 UltraPolymer Donkey anti-Goat IgG (H&L) – HRP Cell IDx Cat# 2GH-050 VIMPCS - murine plasma mimetic medium Wisent Bioproducts Cat# 319-268-cL IgG2b isotype antibodies Invitrogen Cat# 14-4031-82 Antigen Unmasking Solution Vector Laboratories Cat# H-3300 BLOXALL Blocking Solution Vector Laboratories Cat# SP-6000 BLOTTO blocking buffer Thermo Fischer Cat# 37530 HRP-conjugated anti-rabbit polymer Cell IDx Cat# 2RH-50 Opal 570 fluorophore Akoya Biosciences Cat# FP1488001KT citrate-based buffer Vector Cat# H-3300 HRP-conjugated anti-rat polymer Cell IDx Cat# 2AH-50 Opal 690 fluorophore Akoya Biosciences Cat# FP1497001KT Opal 520 fluorophore Akoya Biosciences Cat# FP1487001KT Opal 620 fluorophore Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vector Laboratories Cat# H-1700-10 Growth factor reduced Matrigel Corning Cat# 354262 Bouin’s solution Sigma Cat# HT10132 Red blood cell lysis buffer BioLegend Cat# 420302 Bacterial and virus strains Ad-Cre-GFP Vector Biolabs Cat# 1700 Biological samples Human ascites from paracentesis This paper N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Thermo Fischer Cat# 11875093 DMEM Thermo Fischer Cat# 11995065 Modified DMEM ATCC Cat# 30-2002 Advanced DMEM/F-12 Thermo Fischer Cat# 12634010 Fetal bovine serum R&D Systems Cat# S12450 Insulin/transferrin/selenium Invitrogen Cat# 51300 hydrocortisone Sigma Cat# H0135 Murine Epidermal Growth Factor (EGF) Sigma Cat# E4127 RBC Lysis Buffer (10X) BioLegend Cat# 420302 RIPA Lysis and Extraction Buffer Thermo Cat# 89900 Mouse IL-4 Recombinant Protein PeproTech Cat3 214-14 Lipopolysaccharides (LPS) Sigma-Aldrich Cat# L6529 Mouse M-CSF Recombinant Protein PeproTech Cat3 315-02 Eicosapentaenoic Acid (EPA) MCE Cat# HY-B0660 Linolenic Acid (LA) Thermo Fischer Cat# 21504 Docosahexaenoic Acid (DHA) Cayman Chemical Cat# 90310 PROTAC Degrader FC11 Tocris Bioscience Cat# 7306 DOXOrubicin HCI Liposome Injection Dr. Reddy’s NDC 43598-0283-35 Paclitaxel Pfizer NDC 61703-0342-09 Cisplatin West-Ward NDC 0143-9504-01 Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 Antigen Unmasking Solution, Citrate-Based Vector Laboratories Cat# H-3300-250 BLOXALL® Endogenous Blocking Solution Vector Laboratories Cat# SP-6000-100 Blocker TM BLOTTO in TBS Thermo Fisher Cat# 37530 Opal 570 Reagent Pack Akoya Biosciences Cat# FP1488001KT (Continued on next page) Cell Reports 45, 117009, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Opal 690 Reagent Pack Akoya Biosciences Cat# FP1497001KT Opal 520 Reagent Pack Akoya Biosciences Cat# FP1487001KT Opal 620 Reagent Pack Akoya Biosciences Cat# FP1495001KT VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat# H-1700-10 Ifebemtinib (IN10018) FAK Inhibitor InxMed clinical compound IVISbrite D-Luciferin Potassium Salt Bioluminescent Substrate Revvity Cat# 122799 Corning® Matrigel® Matrix High Concentration (HC), Phenol Red Free, LDEV-free Corning Cat# 354262 Heochst 33342 Thermo Fischer Cat# 62249 Mini ETDA-free Protease inhibitor cocktail Sigma Cat#11836170001 PhoSTOP TM phosphatase inhibitor cocktail Millipore Cat# 4906845001 Clarity Western ECL BioRad Cat# 1705060S Critical commercial assays eBioscience TM Foxp3/Transcription Factor Staining Buffer Set eBioscience Cat# 00-5523-00 LEGENDplex Custom Mouse Panel 750 BioLegend Cat# 900001850 PureLink RNA Mini Kit Invitrogen Cat# 12183018A iScript Reverse Transcription Supermix for RT-qPCR kit Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725121 Abclonal mRNA-seq Lib Prep Kit Illumina Cat# RK20302 Transwell chambers (8 μm) Costar N/A 0.22-μm filter Millipore Cat# SE1M179M6 Pierce TM BCA Protein Assay Kits Thermo Fischer Cat# 23225 Mini-PROTEAN® TGX TM Precast Gels BioRad Cat# 4561033 Corning TM Costar TM poly-HEMA-coated 24-well plates Thermo Fischer Cat# 09-761-146 Deposited data Mouse bulk RNA sequencing of macrophage This paper GEO: GSE320157 Mouse ovarian cancer single cell RNA sequencing This paper GEO: GSE313445 Experimental models: Cell lines KMF (ID8-IP) Ward et al. 55 Schlaepfer Lab THP-1 ATCC Cat# TIB-202 HGS2 Ximbio Cat# 160538 PMJ2-R ATCC Cat# CRL-2458 293T ATCC Cat# CRL-3216 MOVCAR This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 Charles River Laboratories C57BL/6 Mouse Mouse: FAK fl/fl Shen et al. 56 N/A Mouse: TAg Connolly et al. 57 N/A Mouse: LysMcre GATA6fl/fl YFP+ mice Gautier et al. 36 N/A Oligonucleotides Mouse GATA6 Forward CAGCAGGACCCTTCGAAAC Reverse CCATTCATCTTGCTGTAGAGACC This paper N/A Human CXCL13 (BCA1) Forward TCTCTGCTTCTCATGCTGCT Reverse TCAAGCTTGTGTAATAGACCTCCA This paper N/A (Continued on next page) 20 Cell Reports 45, 117009, March 24, 2026
|
Vector Laboratories is a verified supplier 
Vector Laboratories manufactures this product 